ID: 981976308_981976312

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 981976308 981976312
Species Human (GRCh38) Human (GRCh38)
Location 4:150733316-150733338 4:150733353-150733375
Sequence CCAGATTAAGACAGAGAATGTGC CTGAAGTATTTTGAGGTAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 45, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!