ID: 982011878_982011881

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 982011878 982011881
Species Human (GRCh38) Human (GRCh38)
Location 4:151113441-151113463 4:151113470-151113492
Sequence CCACCATGCCTAGCTGGAAGGGA TAATGCACAATTTGTTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 634} {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!