ID: 982235667_982235683

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 982235667 982235683
Species Human (GRCh38) Human (GRCh38)
Location 4:153249256-153249278 4:153249307-153249329
Sequence CCCGCCTTCTTTTCTTCCGCCTG GGGCCTGTTGCTATGGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 741} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!