ID: 982256537_982256551

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 982256537 982256551
Species Human (GRCh38) Human (GRCh38)
Location 4:153456753-153456775 4:153456798-153456820
Sequence CCATCCGCCTTGGCCTCCCAAAG CACCGCGCCCGGCTTTGCGGCGG
Strand - +
Off-target summary {0: 711, 1: 22335, 2: 112806, 3: 168357, 4: 160463} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!