ID: 982458074_982458075

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 982458074 982458075
Species Human (GRCh38) Human (GRCh38)
Location 4:155634457-155634479 4:155634482-155634504
Sequence CCTGCAACAGCGTCACTCTCGTG TTTCAAAGTGTTTGCTTCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 55, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!