ID: 982687974_982687977

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 982687974 982687977
Species Human (GRCh38) Human (GRCh38)
Location 4:158514745-158514767 4:158514794-158514816
Sequence CCACTGACTTGTGATAACCATCA TCTGTTGACTTAAGCAACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136} {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!