ID: 982712160_982712170

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 982712160 982712170
Species Human (GRCh38) Human (GRCh38)
Location 4:158768828-158768850 4:158768854-158768876
Sequence CCGCCCGCCCGCTCCTGGCCGCA CCCACCTCCCGCCTCCCGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 137, 4: 916}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!