ID: 982745975_982745994

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 982745975 982745994
Species Human (GRCh38) Human (GRCh38)
Location 4:159103973-159103995 4:159104022-159104044
Sequence CCGCGCTCTCGGCCGCCGGGCCC GCGCCGCCGCCGCCGCGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 277} {0: 1, 1: 1, 2: 9, 3: 78, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!