ID: 982831590_982831602

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 982831590 982831602
Species Human (GRCh38) Human (GRCh38)
Location 4:160067990-160068012 4:160068021-160068043
Sequence CCAGTTTAGGCTTCCTCACCGCC CTCAGGGCTCCAACTGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!