ID: 983045060_983045066

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 983045060 983045066
Species Human (GRCh38) Human (GRCh38)
Location 4:162976471-162976493 4:162976492-162976514
Sequence CCACCTACCTCGGCCTCCCAAAG AGTACTGAGATTACAGTGCCTGG
Strand - +
Off-target summary {0: 1286, 1: 59092, 2: 190542, 3: 192166, 4: 133072} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!