ID: 983045061_983045068

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 983045061 983045068
Species Human (GRCh38) Human (GRCh38)
Location 4:162976474-162976496 4:162976513-162976535
Sequence CCTACCTCGGCCTCCCAAAGTAC GGCCCTTTTGATGTTCAGACAGG
Strand - +
Off-target summary {0: 988, 1: 42594, 2: 195009, 3: 274734, 4: 183503} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!