ID: 983045062_983045068

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 983045062 983045068
Species Human (GRCh38) Human (GRCh38)
Location 4:162976478-162976500 4:162976513-162976535
Sequence CCTCGGCCTCCCAAAGTACTGAG GGCCCTTTTGATGTTCAGACAGG
Strand - +
Off-target summary {0: 179, 1: 9029, 2: 144833, 3: 285429, 4: 206582} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!