ID: 983045063_983045068

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 983045063 983045068
Species Human (GRCh38) Human (GRCh38)
Location 4:162976484-162976506 4:162976513-162976535
Sequence CCTCCCAAAGTACTGAGATTACA GGCCCTTTTGATGTTCAGACAGG
Strand - +
Off-target summary {0: 633, 1: 26893, 2: 329956, 3: 261714, 4: 139137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!