ID: 983045064_983045068

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 983045064 983045068
Species Human (GRCh38) Human (GRCh38)
Location 4:162976487-162976509 4:162976513-162976535
Sequence CCCAAAGTACTGAGATTACAGTG GGCCCTTTTGATGTTCAGACAGG
Strand - +
Off-target summary {0: 2, 1: 68, 2: 1897, 3: 38475, 4: 363897} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!