ID: 983084653_983084657

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 983084653 983084657
Species Human (GRCh38) Human (GRCh38)
Location 4:163428043-163428065 4:163428091-163428113
Sequence CCAGCAGGAAGTAGCTAGAACAG TAGGGTGTCCTATTTAGAGAGGG
Strand - +
Off-target summary {0: 3, 1: 57, 2: 78, 3: 130, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!