ID: 983208673_983208678

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 983208673 983208678
Species Human (GRCh38) Human (GRCh38)
Location 4:164936460-164936482 4:164936487-164936509
Sequence CCTCCAGAGGCTGCAGCATTGAA CCATCTTGGAAGCAGAGACCAGG
Strand - +
Off-target summary No data {0: 28, 1: 95, 2: 144, 3: 181, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!