ID: 983317462_983317464

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 983317462 983317464
Species Human (GRCh38) Human (GRCh38)
Location 4:166149964-166149986 4:166149992-166150014
Sequence CCAGTCTCGGGCAGCCTTTTATA ATGAGAATGAACTAATATATTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 30, 3: 212, 4: 808}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!