ID: 983380072_983380076

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 983380072 983380076
Species Human (GRCh38) Human (GRCh38)
Location 4:166981122-166981144 4:166981143-166981165
Sequence CCAACAAGTGTCCAGCTTTCAGC GCCCAGAGGAGACCCATAGTGGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 34, 3: 116, 4: 281} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!