ID: 983422555_983422557

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 983422555 983422557
Species Human (GRCh38) Human (GRCh38)
Location 4:167538535-167538557 4:167538563-167538585
Sequence CCATAAAAAGGAATGAAATAACA TGCAATGATCTGGATGAGATTGG
Strand - +
Off-target summary {0: 13, 1: 357, 2: 1042, 3: 2255, 4: 6461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!