ID: 983425215_983425228

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 983425215 983425228
Species Human (GRCh38) Human (GRCh38)
Location 4:167575146-167575168 4:167575194-167575216
Sequence CCTTTAACTAACCTTTGAGCCAG CCTAGGATATTGCCCCCTAAAGG
Strand - +
Off-target summary {0: 25, 1: 23, 2: 14, 3: 17, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!