ID: 983518039_983518044

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 983518039 983518044
Species Human (GRCh38) Human (GRCh38)
Location 4:168677811-168677833 4:168677841-168677863
Sequence CCCTACTCCGCCAGTTAATCCTG ACTTTTCCAGCCCCCACTCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 14, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!