ID: 983561775_983561783

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 983561775 983561783
Species Human (GRCh38) Human (GRCh38)
Location 4:169108838-169108860 4:169108882-169108904
Sequence CCCTACACCTACTAAAGCTTAGA GGATGAAACCAGTGGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81} {0: 1, 1: 0, 2: 0, 3: 20, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!