ID: 983647125_983647133

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 983647125 983647133
Species Human (GRCh38) Human (GRCh38)
Location 4:170003367-170003389 4:170003420-170003442
Sequence CCCACAAACAAAAGAAAATGGAG CTCAATACACAGATGAAGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 93, 4: 926} {0: 1, 1: 0, 2: 1, 3: 21, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!