ID: 983651456_983651461

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 983651456 983651461
Species Human (GRCh38) Human (GRCh38)
Location 4:170040527-170040549 4:170040551-170040573
Sequence CCCACTGGAGTGTGGACTTGTGG GCCTTTTCTGGGCCTCCCCATGG
Strand - +
Off-target summary No data {0: 2, 1: 22, 2: 51, 3: 193, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!