ID: 983651458_983651461 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 983651458 | 983651461 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:170040528-170040550 | 4:170040551-170040573 |
| Sequence | CCACTGGAGTGTGGACTTGTGGT | GCCTTTTCTGGGCCTCCCCATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 22, 2: 51, 3: 193, 4: 494} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||