ID: 983827239_983827243

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 983827239 983827243
Species Human (GRCh38) Human (GRCh38)
Location 4:172278529-172278551 4:172278544-172278566
Sequence CCCTTTCCCTGTATCATCTGTAG ATCTGTAGATCAGTTGTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 268} {0: 1, 1: 0, 2: 1, 3: 5, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!