ID: 983899437_983899444

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 983899437 983899444
Species Human (GRCh38) Human (GRCh38)
Location 4:173118056-173118078 4:173118106-173118128
Sequence CCTACAACCATCTGATCTTTGAC AAGGATTCCCTGTCAATAAATGG
Strand - +
Off-target summary {0: 416, 1: 1474, 2: 1581, 3: 1564, 4: 1472} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!