|
Left Crispr |
Right Crispr |
| Crispr ID |
984041183 |
984041192 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:174735757-174735779
|
4:174735810-174735832
|
| Sequence |
CCGTCATGTTCGCCAGGCTGGTC |
CGTCAGCCTCCCAAAGTGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 65, 2: 1013, 3: 1918, 4: 2381} |
{0: 40, 1: 8391, 2: 114523, 3: 233321, 4: 244023} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|