ID: 984055834_984055835

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 984055834 984055835
Species Human (GRCh38) Human (GRCh38)
Location 4:174928348-174928370 4:174928381-174928403
Sequence CCAGCTTTGTTATGCAAGGTGAA AACCGCATCCTGTAACTGACTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 10, 3: 15, 4: 113} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!