ID: 984077111_984077118

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 984077111 984077118
Species Human (GRCh38) Human (GRCh38)
Location 4:175196981-175197003 4:175197028-175197050
Sequence CCCCGTCTTGACTGAAAATACAG TATCTGTAATCCCAGCTACTCGG
Strand - +
Off-target summary No data {0: 155, 1: 7302, 2: 95462, 3: 165452, 4: 182083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!