ID: 984077111_984077119

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 984077111 984077119
Species Human (GRCh38) Human (GRCh38)
Location 4:175196981-175197003 4:175197029-175197051
Sequence CCCCGTCTTGACTGAAAATACAG ATCTGTAATCCCAGCTACTCGGG
Strand - +
Off-target summary No data {0: 2101, 1: 38336, 2: 160760, 3: 257844, 4: 211149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!