ID: 984077111_984077120

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 984077111 984077120
Species Human (GRCh38) Human (GRCh38)
Location 4:175196981-175197003 4:175197032-175197054
Sequence CCCCGTCTTGACTGAAAATACAG TGTAATCCCAGCTACTCGGGAGG
Strand - +
Off-target summary No data {0: 44593, 1: 206846, 2: 252437, 3: 185282, 4: 427506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!