ID: 984112957_984112967

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 984112957 984112967
Species Human (GRCh38) Human (GRCh38)
Location 4:175643089-175643111 4:175643137-175643159
Sequence CCATAATCAGACCGATTCTTCCC AGCCACCAAAATCTCCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!