ID: 984131354_984131361

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 984131354 984131361
Species Human (GRCh38) Human (GRCh38)
Location 4:175879116-175879138 4:175879166-175879188
Sequence CCCCCTCAGTCTGAATTTCATTG AAGCCATTCACCAAGTCTCTAGG
Strand - +
Off-target summary {0: 2, 1: 32, 2: 506, 3: 1219, 4: 1746} {0: 12, 1: 1552, 2: 1888, 3: 1395, 4: 912}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!