|
Left Crispr |
Right Crispr |
| Crispr ID |
984131354 |
984131363 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:175879116-175879138
|
4:175879169-175879191
|
| Sequence |
CCCCCTCAGTCTGAATTTCATTG |
CCATTCACCAAGTCTCTAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 32, 2: 506, 3: 1219, 4: 1746} |
{0: 1, 1: 145, 2: 152, 3: 102, 4: 137} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|