ID: 984131357_984131361

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 984131357 984131361
Species Human (GRCh38) Human (GRCh38)
Location 4:175879119-175879141 4:175879166-175879188
Sequence CCTCAGTCTGAATTTCATTGCCC AAGCCATTCACCAAGTCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 66, 3: 526, 4: 1373} {0: 12, 1: 1552, 2: 1888, 3: 1395, 4: 912}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!