|
Left Crispr |
Right Crispr |
| Crispr ID |
984131359 |
984131361 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:175879140-175879162
|
4:175879166-175879188
|
| Sequence |
CCATATCATTATTAGCATTTTGG |
AAGCCATTCACCAAGTCTCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 27, 1: 447, 2: 1520, 3: 1697, 4: 1517} |
{0: 12, 1: 1552, 2: 1888, 3: 1395, 4: 912} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|