ID: 984432538_984432542

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 984432538 984432542
Species Human (GRCh38) Human (GRCh38)
Location 4:179666610-179666632 4:179666642-179666664
Sequence CCCTGTCTTTAGCTGAACTAAGG GCAACAATGATACACCTTAAAGG
Strand - +
Off-target summary {0: 32, 1: 85, 2: 132, 3: 176, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!