ID: 984432540_984432542

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 984432540 984432542
Species Human (GRCh38) Human (GRCh38)
Location 4:179666611-179666633 4:179666642-179666664
Sequence CCTGTCTTTAGCTGAACTAAGGA GCAACAATGATACACCTTAAAGG
Strand - +
Off-target summary {0: 66, 1: 150, 2: 203, 3: 202, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!