ID: 984498731_984498737

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 984498731 984498737
Species Human (GRCh38) Human (GRCh38)
Location 4:180531997-180532019 4:180532025-180532047
Sequence CCTTGCCCTCACTCAGCCATTTC ACATTTTTGGTTTTCACAACTGG
Strand - +
Off-target summary No data {0: 11, 1: 147, 2: 460, 3: 766, 4: 1189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!