ID: 984498733_984498738

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 984498733 984498738
Species Human (GRCh38) Human (GRCh38)
Location 4:180532002-180532024 4:180532026-180532048
Sequence CCCTCACTCAGCCATTTCTGGAG CATTTTTGGTTTTCACAACTGGG
Strand - +
Off-target summary No data {0: 12, 1: 147, 2: 530, 3: 861, 4: 1426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!