ID: 984512419_984512426

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 984512419 984512426
Species Human (GRCh38) Human (GRCh38)
Location 4:180694514-180694536 4:180694549-180694571
Sequence CCCTCTTACCACATGTGGGGATT CTCAATATGAGATTTGTGTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!