ID: 984512423_984512427

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 984512423 984512427
Species Human (GRCh38) Human (GRCh38)
Location 4:180694522-180694544 4:180694570-180694592
Sequence CCACATGTGGGGATTTGGGAACT GGACACAGCCAAACTGTATCAGG
Strand - +
Off-target summary No data {0: 16, 1: 69, 2: 569, 3: 581, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!