ID: 984553044_984553046

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 984553044 984553046
Species Human (GRCh38) Human (GRCh38)
Location 4:181183207-181183229 4:181183230-181183252
Sequence CCTTCTATGCGCAAGCCACTCTT TCATTCATTTTTCATCCTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!