ID: 984674317_984674321 |
View in Genome Browser |
Spacer: 22 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 984674317 | 984674321 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:182529524-182529546 | 4:182529569-182529591 |
Sequence | CCATTTCATTCTTCTTCCTTTCT | CACTCCACCCCATTTGGTTCAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 4, 2: 57, 3: 585, 4: 4367} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |