ID: 984734938_984734952

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 984734938 984734952
Species Human (GRCh38) Human (GRCh38)
Location 4:183099649-183099671 4:183099682-183099704
Sequence CCCGTTCGGACACGGCGGCTGTT CCCGGCCGCGCGGGGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17} {0: 1, 1: 0, 2: 3, 3: 223, 4: 7725}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!