ID: 984844687_984844696

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 984844687 984844696
Species Human (GRCh38) Human (GRCh38)
Location 4:184099463-184099485 4:184099506-184099528
Sequence CCCTGACACACAATAGGTGTTCA CCGCAGATGCCCCTGGCCATGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 84, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!