ID: 984928328_984928335

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 984928328 984928335
Species Human (GRCh38) Human (GRCh38)
Location 4:184825872-184825894 4:184825909-184825931
Sequence CCGCCGCGGGAGCAGGCGCGGCT CACTCACCTCCTCCGTGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 157} {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!