ID: 985057936_985057942

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 985057936 985057942
Species Human (GRCh38) Human (GRCh38)
Location 4:186051311-186051333 4:186051331-186051353
Sequence CCCTCCTCTTCCTGTCTTCCCTG CTGCAGCCTGCTTCCCAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 199, 4: 1502} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!