ID: 985129615_985129622

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 985129615 985129622
Species Human (GRCh38) Human (GRCh38)
Location 4:186726610-186726632 4:186726644-186726666
Sequence CCCGGGAGCAGCCAAGTTTGTCA GGCAGCCAGCCGCCGAGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 136} {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!